|
Millennium Science
millennium cat# d-001810-10-05 Millennium Cat# D 001810 10 05, supplied by Millennium Science, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/millennium cat# d-001810-10-05/product/Millennium Science Average 90 stars, based on 1 article reviews
millennium cat# d-001810-10-05 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
scrambled control sirna Scrambled Control Sirna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/scrambled control sirna/product/Shanghai GenePharma Average 90 stars, based on 1 article reviews
scrambled control sirna - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
6-carboxyfluorescein-tagged, negative control (nc) scrambled sirnas 6 Carboxyfluorescein Tagged, Negative Control (Nc) Scrambled Sirnas, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/6-carboxyfluorescein-tagged, negative control (nc) scrambled sirnas/product/Shanghai GenePharma Average 90 stars, based on 1 article reviews
6-carboxyfluorescein-tagged, negative control (nc) scrambled sirnas - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Genechem
scrambled control shrna (5′-actatatatcgtccttaagct-3′) ![]() Scrambled Control Shrna (5′ Actatatatcgtccttaagct 3′), supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/scrambled control shrna (5′-actatatatcgtccttaagct-3′)/product/Genechem Average 90 stars, based on 1 article reviews
scrambled control shrna (5′-actatatatcgtccttaagct-3′) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Qiagen
pgc1 α mixed or control scrambled sirna ![]() Pgc1 α Mixed Or Control Scrambled Sirna, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgc1 α mixed or control scrambled sirna/product/Qiagen Average 90 stars, based on 1 article reviews
pgc1 α mixed or control scrambled sirna - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Xeragon Inc
fluorescence-labelled control, scrambled and human p140cap-specific sirnas (aagctgtgtctgttgaggctg) ![]() Fluorescence Labelled Control, Scrambled And Human P140cap Specific Sirnas (Aagctgtgtctgttgaggctg), supplied by Xeragon Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/fluorescence-labelled control, scrambled and human p140cap-specific sirnas (aagctgtgtctgttgaggctg)/product/Xeragon Inc Average 90 stars, based on 1 article reviews
fluorescence-labelled control, scrambled and human p140cap-specific sirnas (aagctgtgtctgttgaggctg) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Ribobio co
sirna of arg2, ho-1, creb1 and their matched scramble control ![]() Sirna Of Arg2, Ho 1, Creb1 And Their Matched Scramble Control, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sirna of arg2, ho-1, creb1 and their matched scramble control/product/Ribobio co Average 90 stars, based on 1 article reviews
sirna of arg2, ho-1, creb1 and their matched scramble control - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Ribobio co
scrambled control sirna ![]() Scrambled Control Sirna, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/scrambled control sirna/product/Ribobio co Average 90 stars, based on 1 article reviews
scrambled control sirna - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Qiagen
scramble control sirnas 1027281 Figure S5 . " width="250" height="auto" />Scramble Control Sirnas 1027281, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/scramble control sirnas 1027281/product/Qiagen Average 90 stars, based on 1 article reviews
scramble control sirnas 1027281 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Qiagen
sirna predesigned control (scrambled or scr), kdr sirna sequences Figure S5 . " width="250" height="auto" />Sirna Predesigned Control (Scrambled Or Scr), Kdr Sirna Sequences, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sirna predesigned control (scrambled or scr), kdr sirna sequences/product/Qiagen Average 90 stars, based on 1 article reviews
sirna predesigned control (scrambled or scr), kdr sirna sequences - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Ribobio co
a scrambled control small interfering rna (sirna) ![]() A Scrambled Control Small Interfering Rna (Sirna), supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/a scrambled control small interfering rna (sirna)/product/Ribobio co Average 90 stars, based on 1 article reviews
a scrambled control small interfering rna (sirna) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
taqman her-2 rt-qpcr kits ![]() Taqman Her 2 Rt Qpcr Kits, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/taqman her-2 rt-qpcr kits/product/Shanghai GenePharma Average 90 stars, based on 1 article reviews
taqman her-2 rt-qpcr kits - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Oncotarget
Article Title: CD226 reduces endothelial cell glucose uptake under hyperglycemic conditions with inflammation in type 2 diabetes mellitus
doi: 10.18632/oncotarget.7505
Figure Lengend Snippet: Cells were pre-incubated with 100 μM 2-NBDG for 30 min. Flow cytometry histogram of 20,000 cells. A. Representative flow cytometry analysis of 2-NBDG glucose uptake following different treatments. B. Glucose uptake expressed as percent of control and mean changes in 2-NBDG fluorescence intensity (MFI). Significant differences vs . the TNF-α group are indicated, * p < 0.05. C. Membrane expression of Glut1 increased after CD226 shRNA lentivirus infection with or without TNF-α treatment. Data are shown as the mean of three independent experiments.
Article Snippet: For CD226 knockdown, lentivirus encoding CD226 shRNA (5′-GCACTGTGTGAAGAGACATTG-3′) or scrambled
Techniques: Incubation, Flow Cytometry, Fluorescence, Expressing, shRNA, Infection
Journal: Oncotarget
Article Title: CD226 reduces endothelial cell glucose uptake under hyperglycemic conditions with inflammation in type 2 diabetes mellitus
doi: 10.18632/oncotarget.7505
Figure Lengend Snippet: HUVECs grown on chamber-slides after treatment were fixed and stained with FITC-phalloidin to detect F-actin as described in Materials and Methods. A. Control cells pretreated with scrambled control shRNA for 48 h and high glucose for another 12 h had few stress fibers. B. Following incubation with 10 ng/ml TNF-α and high glucose for another 12 h, F-actin was redistributed to the subcortical compartment and stress fibers formed. C. , D. Pretreatment with CD226 shRNA lentivirus for 48 h prevented redistribution of F-actin with or without TNF-α stimulation and 12 h of high glucose. Results are representative of three independent experiments.
Article Snippet: For CD226 knockdown, lentivirus encoding CD226 shRNA (5′-GCACTGTGTGAAGAGACATTG-3′) or scrambled
Techniques: Staining, shRNA, Incubation
Journal: Human Molecular Genetics
Article Title: Dynamic transcriptomic analysis reveals suppression of PGC1 α /ERR α drives perturbed myogenesis in facioscapulohumeral muscular dystrophy
doi: 10.1093/hmg/ddy405
Figure Lengend Snippet: Transcriptomic analysis of FSHD myogenesis reveals suppression of PGC1 α and ERR α . ( A ) A multivariate regression model was fit to the time course RNA-seq data describing the control 54-6 and FSHD 54-12 myoblasts during myogenesis. Coefficient a i attains positive values if gene i is up-regulated in FSHD versus controls and negative values if down-regulated. Coefficient b i attains positive values if gene i is up-regulated during myogenic differentiation and negative values if down-regulated. Coefficient c i attains positive values if gene i is up-regulated during differentiation in FSHD and negative values if down-regulated. As an example, time course expression plots are shown for the genes with the highest coefficient values for coefficient a i (CDKN2A) , b i (MYOM2) and c i (DOC2B) , where thick lines represent mean expression across triplicates and thin lines denote maximum and minimum expression values observed across triplicates. ( B ) Bar plot displays log 10 enrichment P -values for the top 5 enriched gene sets among the 500 genes with the most negative c i coefficient (i.e. those suppressed in FSHD myogenesis). We see clear enrichment for target genes of ERR α and genes involved in mitochondrial processes. ( C ) Expression of ESRRA (ERR α ) in FSHD 54-12 and matched control 54-6 myoblasts from RNA-seq analysis. Significant repression in FSHD myogenesis begins from day 1 of differentiation. Thick lines represent mean expression across triplicates and thin lines denote maximum and minimum expression values observed across triplicates. ( D ) Expression of PPARGC1A (PGC1 α ) in FSHD 54-12 and matched control 54-6 myoblasts from RNA-seq analysis. Significant repression in FSHD myoblasts occurs at all time points analysed. Thick lines represent mean expression across triplicates and thin lines denote maximum and minimum expression values observed across triplicates. ( E ) The 500 genes with the most negative c i coefficient (i.e. those suppressed in FSHD myogenesis) identified in the data set of the FSHD 54-12 and control 54-6 myoblasts were tested on RNA-seq data from FSHD 16Abic and control 16Ubic at time 0, confluent myoblasts (myob) and time 5040 min, mature myotubes (Myot). Box-plots demonstrate that the mean expression of these 500 genes with the most negative c i coefficient was also significantly lower in 16Abic FSHD myotubes versus 16Ubic control myotubes. The box represents the interquartile range (IQR), with the median indicated by a line. Whiskers denote min [1.5 * IQR, max (observed value)]; values were tested using an unpaired two-tailed t -test. ( F ) Expression of PPARGC1A (PGC1 α ) is suppressed in RNA-seq from FSHD 16Abic, 12Abic, 54-2 and 54-A5 cell lines at both time 0, confluent myoblasts and time 5040 min, mature myotube stage, compared to control 16Ubic, 12Ubic, 54-A10 cell lines. The box represents the IQR, with the median indicated by a line. Whiskers denote min [1.5 * IQR, max (observed value)]; values were z -normalised within FSHD-control groups and tested using an unpaired Wilcoxon test. ( G ) Expression of ESRRA (ERR α ) is suppressed only in RNA-seq from FSHD 16Abic, 12Abic, 54-2 and 54-A5 cell lines at the time 5040 min mature myotube stage, compared to control 16Ubic, 12Ubic and 54-A10 cell lines. The box represents the IQR, with the median indicated by a line. Whiskers denote min [1.5 * IQR, max (observed value)]; values were z -normalised within FSHD-control groups and tested using an unpaired Wilcoxon test.
Article Snippet:
Techniques: RNA Sequencing Assay, Expressing, Two Tailed Test
Journal: Human Molecular Genetics
Article Title: Dynamic transcriptomic analysis reveals suppression of PGC1 α /ERR α drives perturbed myogenesis in facioscapulohumeral muscular dystrophy
doi: 10.1093/hmg/ddy405
Figure Lengend Snippet: siRNA-mediated knock-down of PGC1 α is sufficient to cause the hypotrophic FSHD myotube phenotype, which can be rescued by the ERR α agonist biochanin A. ( A ) RT-qPCR demonstrates that four combined siRNAs against PGC1 α successfully suppresses PGC1 α ( PPARGC1A ) in control 54-6 myoblasts. Data expressed as mean ± SEM where an asterisk denotes significant difference ( P < 0.05) using an unpaired two-tailed t -test. ( B ) Control 54-6 myoblasts were transfected with a mixture of four siRNAs against PGC1 α or a scrambled siRNA control and induced to differentiate for 3 days. Control 54-6 myoblasts were also transfected with combined siRNAs against PGC1 α or a scrambled siRNA control but also exposed to 10 μm biochanin A during 3 days of differentiation. Myotubes were then immunolabelled for MyHC and all nuclei counterstained with DAPI (Magnification: ×100). ( C ) PGC1 α knock-down significantly reduced MyHC+ve area. However, this PGC1 α knock-down mediated reduction in MyHC+ve area could be rescued to control levels by administration of 10 μm biochanin A to the differentiation medium. Data expressed as mean ± SEM ( n = 3 wells per line) where an asterisk denotes significant difference between the MyHC+ve area in 54-6 control siRNA/untreated versus treated conditions ( P < 0.05) using an unpaired two-tailed t -test.
Article Snippet:
Techniques: Quantitative RT-PCR, Two Tailed Test, Transfection
Journal: Human Molecular Genetics
Article Title: Dynamic transcriptomic analysis reveals suppression of PGC1 α /ERR α drives perturbed myogenesis in facioscapulohumeral muscular dystrophy
doi: 10.1093/hmg/ddy405
Figure Lengend Snippet: Suppression of PGC1 α / ERR α expression in FSHD and rescue by ERR α agonists. Schematic summarising that PGC1 α /ERR α suppression in FSHD drives an FSHD hypotrophic phenotype that can be rescued by ERR α agonists biochanin A, daidzein or genistein. Suppression of the ERR α /PGC1 α pathway in FSHD patients could also contribute to know features of FSHD pathology including oxidative stress sensitivity, aberrant vasculature and inflammation.
Article Snippet:
Techniques: Expressing
Figure S5 . " width="100%" height="100%">
Journal: Stem Cell Reports
Article Title: FUS Mutant Human Motoneurons Display Altered Transcriptome and microRNA Pathways with Implications for ALS Pathogenesis
doi: 10.1016/j.stemcr.2017.09.004
Figure Lengend Snippet: miR-375 Is Downregulated in FUS Mutant MNs (A) Venn diagram showing the relations between differentially expressed miRNAs at different time points of MN maturation, as resulting from TaqMan array cards analysis in FUS WT and FUS P525L iPSC-derived MNs at day 12 and 12 + 7, and small RNA-seq at day 12 + 7 (p < 0.05). (B) Validation of selected miRNAs by real-time qRT-PCR in MNs at day 12 + 7. Expression levels in FUS P525L and FUS P525L #2 are shown as relative to their respective isogenic FUS WT controls, set to a value of 1. Histogram bars represent the average of at least four independent experiments and error bars indicate the SD (Student's t test; paired; two tails; ∗ p < 0.05; ∗∗∗ p < 0.001; n.s., p > 0.05). (C) Real-time qRT-PCR analysis of the indicated miRNAs in FUS WT undifferentiated iPSCs and MNs (day 12 of differentiation, unsorted). miR-302a and miR-367 are pluripotency miRNAs; miR-218 is an MN-enriched miRNA. For each miRNA, the sample with the highest expression has been used as the calibrator. Histogram bars represent the average of a technical replicate (n = 3) and error bars indicate the SD. (D) Real-time qRT-PCR analysis in differentiated FUS WT iPSCs (day 12) transfected with anti-FUS or control siRNAs. Histogram bars represent the expression relative to the siRNA control (average of three independent experiments). Error bars indicate the SD (Student's t test; paired; two tails; ∗ p < 0.05; ∗∗ p < 0.01; where not indicated p > 0.05). See also
Article Snippet: Differentiating FUS WT iPSCs were transfected at 8 and 10 days with 40 nM anti-FUS siRNAs (SI00070518, QIAGEN) or
Techniques: Mutagenesis, Derivative Assay, RNA Sequencing, Biomarker Discovery, Quantitative RT-PCR, Expressing, Transfection, Control
Journal: Frontiers in Pharmacology
Article Title: LncRNA Profile Study Reveals a Three-LncRNA Signature Associated With the Pathological Complete Response Following Neoadjuvant Chemotherapy in Breast Cancer
doi: 10.3389/fphar.2019.00574
Figure Lengend Snippet: Knockdown of BC032585 lncRNA increases cell resistance to chemotherapeutic agents in MDA-MB-231 and MCF-7 breast cancer cells. (A,B) MDA-MB-231 and MCF-7 cells were transfected with a specific BC032585 siRNA ( BC032585 siRNA –1, 2, 3, and 100 nM), or a negative control siRNA (control siRNA) for 24, 48, and 72 h. The transfected cells were then harvested for quantification of BC032585 lncRNA by real-time PCR. The RNA levels were expressed as fold of corresponding controls, and the data are mean ± SD of three independent experiment. ∗∗∗ p < 0.001 compared to the corresponding controls. (C,D) MDA-MB-231 cells were transfected with either BC032585 siRNAs or control siRNA for 24 h, and then plated in 96-well plates and treated with various doses of DOX alone or in combination with 0.05 μM PTX for 48 h. The number of viable cells (cell viability) was determined at the end of treatment and expressed as a percentage of corresponding vehicle control. The data are the mean ± SEM of two or three independent triplicate experiments. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 compared to corresponding controls. (E,F) MCF-7 cells in 96-well plate were transfected with either BC032585 siRNAs or control siRNA for 48 h and then treated with various doses of DOX alone or in combination with 0.05 μM PTX for another 48 h. The number of viable cells (cell viability) was determined at the end of treatment and expressed as a percentage of corresponding vehicle control. The data are the mean ± SEM of two or three independent triplicate experiments. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001 compared to corresponding controls.
Article Snippet: Three small-interfering RNA (siRNA-1, -2, -3) against BC032585 gene and a scrambled
Techniques: Transfection, Negative Control, Real-time Polymerase Chain Reaction
Journal: Frontiers in Pharmacology
Article Title: LncRNA Profile Study Reveals a Three-LncRNA Signature Associated With the Pathological Complete Response Following Neoadjuvant Chemotherapy in Breast Cancer
doi: 10.3389/fphar.2019.00574
Figure Lengend Snippet: Knockdown of BC032585 lncRNA increases MDR1 expression in MDA-MB-231 breast cancer cells. (A,B) MDA-MB-231 cells were transiently transfected with a specific BC032585 siRNA (100 nM) or a control siRNA for 48 h (A) and 96 h (B) . The transfected cells were then harvested for quantification of MDR1 protein levels by Western blot analysis. β-actin was used as an internal loading control. The protein levels were expressed as fold of corresponding controls, and the data are mean ± SD of two or three independent experiments. ∗ p < 0.05, ∗∗ p < 0.01 compared to the corresponding control.
Article Snippet: Three small-interfering RNA (siRNA-1, -2, -3) against BC032585 gene and a scrambled
Techniques: Expressing, Transfection, Western Blot